Review of Transcription vs. Translation

Practice: What is the central dogma of molecular biology directly referring to?

Practice: Consider a DNA template strand of the following sequence: 5’-A C T G C C A G G A A T-3’.

A) What is the sequence of the corresponding DNA coding strand?  Include directionality.

   DNA Template Strand:  5’-A C T G C C A G G A A T-3’.

   DNA Coding Strand:

B) What is the sequence of the corresponding mRNA strand?  Include directionality.

   mRNA Strand:

Practice: Consider a DNA coding strand with the following sequence:  3’-C T T C A T A G C T C G-5’.

Use the genetic code to determine the corresponding amino acid sequence of the translated protein.

      DNA Coding Strand: 3’- C  T  T  C  A  T  A  G  C  T  C  G -5’

               mRNA Strand:

         Protein Sequence:

Practice: Which of the following polypeptide chains are synthesized from the RNA sequence:

5’ – AUGAUCCGAAGUGGCACAGCAUAA - 3’