Clutch Prep is now a part of Pearson
Ch. 15 - Gene ExpressionWorksheetSee all chapters
All Chapters
Ch. 1 - Introduction to Biology
Ch. 2 - Chemistry
Ch. 3 - Water
Ch. 4 - Biomolecules
Ch. 5 - Cell Components
Ch. 6 - The Membrane
Ch. 7 - Energy and Metabolism
Ch. 8 - Respiration
Ch. 9 - Photosynthesis
Ch. 10 - Cell Signaling
Ch. 11 - Cell Division
Ch. 12 - Meiosis
Ch. 13 - Mendelian Genetics
Ch. 14 - DNA Synthesis
Ch. 15 - Gene Expression
Ch. 16 - Regulation of Expression
Ch. 17 - Viruses
Ch. 18 - Biotechnology
Ch. 19 - Genomics
Ch. 20 - Development
Ch. 21 - Evolution by Natural Selection
Ch. 22 - Evolution of Populations
Ch. 23 - Speciation
Ch. 24 - History of Life on Earth
Ch. 25 - Phylogeny
Ch. 26 - Prokaryotes
Ch. 28 - Protists
Ch. 29 - Plants
Ch. 30 - Fungi
Ch. 31 - Overview of Animals
Ch. 32 - Invertebrates
Ch. 33 - Vertebrates
Ch. 34 - Plant Anatomy
Ch. 35 - Vascular Plant Transport
Ch. 36 - Soil
Ch. 37 - Plant Reproduction
Ch. 38 - Plant Sensation and Response
Ch. 39 - Animal Form and Function
Ch. 40 - Digestive System
Ch. 41 - Circulatory System
Ch. 42 - Immune System
Ch. 43 - Osmoregulation and Excretion
Ch. 44 - Endocrine System
Ch. 45 - Animal Reproduction
Ch. 46 - Nervous System
Ch. 47 - Sensory Systems
Ch. 48 - Muscle Systems
Ch. 49 - Ecology
Ch. 50 - Animal Behavior
Ch. 51 - Population Ecology
Ch. 52 - Community Ecology
Ch. 53 - Ecosystems
Ch. 54 - Conservation Biology
Sections
Central Dogma
Introduction to Transcription
Steps of Transcription
Eukaryotic RNA Processing and Splicing
Introduction to Types of RNA
Genetic Code
Introduction to Translation
Steps of Translation
Post-Translational Modification
Review of Transcription vs. Translation
Mutations

Concept #1: Review of Transcription vs. Translation

Practice: What is the central dogma of molecular biology directly referring to?

Practice: Consider a DNA template strand of the following sequence: 5’-A C T G C C A G G A A T-3’.

A) What is the sequence of the corresponding DNA coding strand?  Include directionality.

   DNA Template Strand:  5’-A C T G C C A G G A A T-3’.

   DNA Coding Strand:

B) What is the sequence of the corresponding mRNA strand?  Include directionality.

   mRNA Strand:

Practice: Consider a DNA coding strand with the following sequence:  3’-C T T C A T A G C T C G-5’.

Use the genetic code to determine the corresponding amino acid sequence of the translated protein.

      DNA Coding Strand: 3’- C  T  T  C  A  T  A  G  C  T  C  G -5’

               mRNA Strand:

         Protein Sequence:


Practice: Which of the following polypeptide chains are synthesized from the RNA sequence:

5’ – AUGAUCCGAAGUGGCACAGCAUAA - 3’